GFP gene

Non-professional visitors (i.e., lay people, high school and undergraduate students) or professionals from other fields should use this forum for general questions regarding molecular biology. No guarantee that they'll be answered but you can always try!

Moderators: r.rosati, mchlbrmn

GFP gene

Postby scm3 » Dec 14 2016 6:43 pm

Does anybody have the primer sequence of GFP gene?
Posts: 1
Joined: Dec 14 2016 6:36 pm

Re: GFP gene

Postby relaxin » Dec 16 2016 6:16 pm


These PCR primers are obtained online, please double check with your own sequence.
Retired academic researcher. Mention of a specific product does not imply my endorsement of the product. No conflict of interest or guarantee to work on the advice given. Do as I say, not as I do. Not liable to the loss of your valuable samples.
PI of Posters
PI of Posters
Posts: 7190
Joined: Jan 11 2006 5:40 pm
Location: Mauna Kea

Re: GFP gene

Postby PatriciaThomas » Nov 14 2017 8:45 am

GFP stands for green fluorescent protein reporter strains were inoculated into mice in a disseminated candidiasis model, and GFP production was monitored by immuno histochemistry and reverse transcription-PCR (RT-PCR). GFP production from the ALS1 and ALS3 promoters was detected immunohistochemically. ALS1, ALS2, ALS3, ALS4, and ALS9 transcription was detected by RT-PCR. I would probably Use eGFP N:CTGGTCGAGCTGGACGGCGACG eGFP C:CATGGTCCTGCTGGAGTTCGTG to sequence them.
Posts: 3
Joined: Oct 28 2017 6:26 am

Re: GFP gene

Postby 29yrsExperience » Dec 14 2017 7:08 pm

Just make sure you know exactly which GFP you are trying to amplify or sequence- there are a lot of variations and though the proteins have similar properties, the nucleotide sequences can be way different. This is because GFP genes have been extracted from various, very distantly related species from Jellyfish to copepods! Good luck!
Posts: 57
Joined: Aug 11 2017 5:58 pm

Return to Student Questions

Who is online

Users browsing this forum: No registered users and 1 guest